Basic Information
ID: ALA4411647
Type: Binding
Description: Stabilization of AR1 template G-quadruplex DNA (unknown origin) assessed as inhibition of polymerase progression at G4 site by measuring reduction in full length amplified product using GGCAAAAAGCAGCTGCTTATATGCAG as primer at 12.5 to 200 nM after 30 mins in presence of 5'-end labeled [gamma32P]ATP by phosphorimaging based taq polymerase stop assay
Organism: Not specified
Activity Charts
Bioactivity
Activity Types for Assay ALA4411647
Inhibition
Compound Summary
| Parent Molecular Weight | ALogP | Polar Surface Area |
|---|---|---|
| 613.55 | 2.49 | 2.49 |