Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-Cy...

Basic Information

ID: ALA4428286

Type: Binding

Description: Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-Cy5) substrate

Format: BAO_0000357

Organism: Human immunodeficiency virus

Target: Human immunodeficiency virus type 1 integrase(ALA3471)

Document: ALA4428027

Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-Cy5) substrate: 1

Associated Items: Associated Bioactivities Associated Compounds

Activity Charts

Bioactivity

Activity Types for Assay ALA4428286

IC50

Total(18)

Compound Summary

Parent Molecular Weight	ALogP	Polar Surface Area
289.26	1.90	1.90
325.32	2.19	2.19
328.33	1.80	1.80
334.34	2.07	2.07
325.32	2.19	2.19
309.33	2.49	2.49
355.35	2.20	2.20
339.35	2.20	2.20
326.31	1.95	1.95
334.34	2.07	2.07
355.35	2.20	2.20
355.35	2.20	2.20
313.29	2.32	2.32
340.34	2.25	2.25
309.33	2.49	2.49
326.31	1.95	1.95
309.33	2.19	2.19
339.35	2.20	2.20