Basic Information
ID: ALA5125874
Type: Binding
Description: Inhibition of wild type full length recombinant human DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells assessed as decrease the fluorescence anisotrophy of DNA bound protein using FAM/TGGATATCTAGGGGCGCTATGATAT as substrate incubated for 5 mins by microplate reader based fluorescence anisotropy assay
Organism: Homo sapiens
Activity Charts
Bioactivity
Activity Types for Assay ALA5125874
Inhibition
Compound Summary
| Parent Molecular Weight | ALogP | Polar Surface Area |
|---|---|---|
| 546.67 | 5.41 | 5.41 |
| 584.72 | 5.96 | 5.96 |