Assay Report Card

Basic Information

ID: ALA5125875

Type: Binding

Description: Inhibition of wild type full length recombinant human DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells assessed as decrease the fluorescence anisotrophy of DNA bound protein using FAM/TGGATATCTAGGGGCGCTATGATAT as substrate and high concentration of protein incubated for 5 mins by microplate reader based fluorescence anisotropy assay

Organism: Homo sapiens

Activity Charts

Compound Summary

Parent Molecular WeightALogPPolar Surface Area
546.675.415.41
584.725.965.96