ID: ALA5125875
Type: Binding
Description: Inhibition of wild type full length recombinant human DNMT3A expressed in NiCo21(DE3) competent Escherichia coli cells assessed as decrease the fluorescence anisotrophy of DNA bound protein using FAM/TGGATATCTAGGGGCGCTATGATAT as substrate and high concentration of protein incubated for 5 mins by microplate reader based fluorescence anisotropy assay
Organism: Homo sapiens
Bioactivity
Activity Types for Assay ALA5125875
Inhibition
Parent Molecular Weight | ALogP | Polar Surface Area |
---|---|---|
546.67 | 5.41 | 5.41 |
584.72 | 5.96 | 5.96 |