# | Aladdin ID | Assay Type | Description | Organism | Compounds | Reference | BAO Format | Source | |
---|---|---|---|---|---|---|---|---|---|
1. | ALA3870890 | Binding | Binding affinity to synthetic 5'-FAM-labelled pre-miR-122 RNA site1 (unknown origin) assessed as heteroduplex formation at 4 uM measured after 2 hrs by denaturing PAGE analysis relative to control | Not specified | 2 | ALA3870329 | nucleic acid format | Scientific Literature | |
2. | ALA3870893 | Binding | Binding affinity to synthetic 5'-fluorescein-labelled pre-miR-122 RNA site1 (unknown origin) assessed as heteroduplex formation at 4 uM measured after 48 hrs by non-denaturing PAGE analysis relative to control | Not specified | 2 | ALA3870329 | nucleic acid format | Scientific Literature | |
3. | ALA3870898 | Binding | Binding affinity to synthetic 5'-FAM-labelled pre-miR-122 RNA site1 (unknown origin) assessed as human dicer-mediated digestion of pre-miR-122 RNA preincubated with RNA for 2 days followed by dicer addition measured after 2 hrs by denaturing PAGE analysis | Not specified | 2 | ALA3870329 | nucleic acid format | Scientific Literature | |
4. | ALA3870899 | Binding | Binding affinity to synthetic 5'-FAM-labelled pre-miR-122 RNA site1 (unknown origin) assessed as inhibition of human dicer-mediated digestion of pre-miR-122 RNA preincubated with RNA for 2 days followed by dicer addition measured after 2 hrs by denaturing PAGE analysis relative to control | Not specified | 2 | ALA3870329 | nucleic acid format | Scientific Literature | |
5. | ALA3870902 | Binding | Binding affinity to 5'-end FAM-tagged CACUAUUACCGCAAACUAUC RNA (unknown origin) assessed as induction of crosslinking by measuring heteroduplex formation at 4 uM measured after 24 hrs by bromophenol blue staining-based denaturing PAGE analysis | Not specified | 1 | ALA3870329 | nucleic acid format | Scientific Literature |