#	Aladdin ID	Assay Type	Description	Organism	Compounds	Reference	BAO Format	Source
1.	ALA4428279	Binding	Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS1 substrate	Human immunodeficiency virus 1	66	ALA4428027	single protein format	Scientific Literature
2.	ALA4428280	Binding	Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrate	Human immunodeficiency virus 1	65	ALA4428027	single protein format	Scientific Literature
3.	ALA4428281	Binding	Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3 substrate	Human immunodeficiency virus 1	65	ALA4428027	single protein format	Scientific Literature
4.	ALA4428282	Binding	Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragment	Human immunodeficiency virus 1	65	ALA4428027	single protein format	Scientific Literature
5.	ALA4428283	Binding	Inhibition of polymerase activity of HIV1 reverse transcriptase using poly(rA)-oligo(dT)16 and [3H]-TTP incubated for 20 mins by liquid scintillation spectrometry	Human immunodeficiency virus 1	66	ALA4428027	single protein format	Scientific Literature
6.	ALA4428285	Toxicity	Toxicity against human HeLa P4/R5 cells	Homo sapiens	66	ALA4428027	cell-based format	Scientific Literature
7.	ALA4428286	Binding	Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-Cy5) substrate	Human immunodeficiency virus	18	ALA4428027	single protein format	Scientific Literature
8.	ALA4428287	Binding	Selectivity index, ratio of IC50 for HIV integrase to IC50 for inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase		17	ALA4428027	assay format	Scientific Literature
9.	ALA4428288	Binding	Selectivity index, ratio of IC50 for inhibition of polymerase activity of HIV1 reverse transcriptase to IC50 for inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase	Human immunodeficiency virus 1	4	ALA4428027	assay format	Scientific Literature
10.	ALA4428289	Functional	Antiviral activity against HIV1 infected in human HeLa P4/R5 cells assessed as reduction in viral growth pre-incubated with cells for 16 hrs followed by additional 48 hrs incubation by fluorescence-based beta-galactosidase detection assay	Human immunodeficiency virus 1	4	ALA4428027	organism-based format	Scientific Literature