| # | Aladdin ID | Assay Type | Description | Organism | Compounds | Reference | BAO Format | Source | |
|---|---|---|---|---|---|---|---|---|---|
| 1. | ALA4348707 | Binding | Inhibition of human topoisomerase 1 using supercoiled pBR322 plasmid DNA as substrate after 15 mins by ethidium bromide staining based agarose gel electrophoresis method | Homo sapiens | 45 | ALA4346697 | single protein format | Scientific Literature | |
| 2. | ALA4348708 | Binding | Binding affinity to calf thymus DNA assessed as bathochromic shift at 25 uM by fluorescence spectra analysis | Bos taurus | 2 | ALA4346697 | nucleic acid format | Scientific Literature | |
| 3. | ALA4348709 | Binding | Binding affinity to d(CCTTACGTGCATAGTCATTCATGACCG) dsDNA (unknown origin) assessed as bathochromic shift at 25 uM by fluorescence spectra analysis | Not specified | 2 | ALA4346697 | assay format | Scientific Literature | |
| 4. | ALA4348710 | Functional | Antiproliferative activity against human NCI60 cells | Homo sapiens | 2 | ALA4346697 | cell-based format | Scientific Literature | |
| 5. | ALA4348711 | Binding | Inhibition of human topoisomerase 2 by decatenation assay | Homo sapiens | 2 | ALA4346697 | single protein format | Scientific Literature |
The page will load shortly, Thanks for your patience!