# | Aladdin ID | Assay Type | Description | Organism | Compounds | Reference | BAO Format | Source | |
---|---|---|---|---|---|---|---|---|---|
1. | ALA4827621 | Binding | Inhibition of METTL3 (unknown origin) using 3' biotinylated RNA (UCUGGACUAAA) and 3H-SAM as a substrate preincubated for 5 mins followed by substrate addition incubated for 30 mins by scintillation counting method | Homo sapiens | 6 | ALA4825715 | single protein format | Scientific Literature | |
2. | ALA4827622 | Binding | Inhibition of METTL3-mediated m6A methylation in human MOLM-3 cells assessed as reduction in mRNA level measured after 24 hrs by LC-MS/MS analysis | Homo sapiens | 6 | ALA4825715 | cell-based format | Scientific Literature | |
3. | ALA5051761 | Binding | Inhibition of METTL3 (unknown origin) using UCUGGACUAAA-biotin and 3H-SAM as substrates preincubated for 5 mins followed by substrate addition incubated for 30 mins by TopCount scintillation counting method | Homo sapiens | 222 | ALA5050857 | single protein format | Patent Bioactivity Data | |
4. | ALA5051762 | Binding | Inhibition of PRMT5 (unknown origin) using Ac-SGRGKGGKGLGKGGAKRHRKVGGK-Biotin and 3H-SAM as substrates preincubated for 5 mins followed by substrate addition incubated for 60 mins by TopCount scintillation counting method | Homo sapiens | 221 | ALA5050857 | single protein format | Patent Bioactivity Data | |
5. | ALA5051763 | Binding | Inhibition of METTL1 (unknown origin) using GCCGAGAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUG GUUCAAUCCCGGGUUUCGGCA-biotin and 3H-SAM as substrates preincubated for 5 mins followed by substrate addition incubated for 20 mins by TopCount scintillation counting method | Homo sapiens | 143 | ALA5050857 | assay format | Patent Bioactivity Data | |
6. | ALA5051765 | Binding | Inhibition of METTL3-mediated m6A methylation in human MOLM-13 cells assessed as reduction in mRNA level measured after 24 hrs by LC-MS/MS analysis | Homo sapiens | 50 | ALA5050857 | cell-based format | Patent Bioactivity Data | |
7. | ALA5051766 | Functional | Antiproliferative activity against human MOLM-13 cells after 48 hrs by Cell Titer-Glo assay | Homo sapiens | 65 | ALA5050857 | cell-based format | Patent Bioactivity Data | |
8. | ALA5051767 | Functional | Antiproliferative activity against human MOLM-13 cells after 96 hrs by Cell Titer-Glo assay | Homo sapiens | 71 | ALA5050857 | cell-based format | Patent Bioactivity Data |