#	Aladdin ID	Assay Type	Description	Organism	Compounds	Reference	BAO Format	Source
1.	ALA5053377	F	Antiproliferative activity against human MOLM-13 cells after 96 hrs by Cell Titer-Glo assay	Homo sapiens	80		cell-based format	Patent Bioactivity Data
2.	ALA5053379	B	Inhibition of METTL3-mediated m6A methylation in human MOLM-13 cells assessed as reduction in mRNA level measured after 24 hrs by LC-MS/MS analysis	Homo sapiens	51		cell-based format	Patent Bioactivity Data
3.	ALA5053381	B	Inhibition of METTL1 (unknown origin) using GCCGAGAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUG GUUCAAUCCCGGGUUUCGGCA-biotin and 3H-SAM as substrates preincubated for 5 mins followed by substrate addition incubated for 20 mins by TopCount scintillation counting method	Homo sapiens	94		assay format	Patent Bioactivity Data
4.	ALA5053382	B	Inhibition of PRMT5 (unknown origin) using Ac-SGRGKGGKGLGKGGAKRHRKVGGK-Biotin and 3H-SAM as substrates preincubated for 5 mins followed by substrate addition incubated for 60 mins by TopCount scintillation counting method	Homo sapiens	192		single protein format	Patent Bioactivity Data
5.	ALA5053383	B	Inhibition of METTL3 (unknown origin) using UCUGGACUAAA-biotin and 3H-SAM as substrates preincubated for 5 mins followed by substrate addition incubated for 30 mins by TopCount scintillation counting method	Homo sapiens	237		single protein format	Patent Bioactivity Data