| # | Aladdin ID | Assay Type | Description | Organism | Compounds | Reference | BAO Format | Source | |
|---|---|---|---|---|---|---|---|---|---|
| 1. | ALA5098052 | B | Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as DNA substrate incubated for 2 hrs by densitometric analysis | Human immunodeficiency virus 1 | 14 | assay format | Scientific Literature | ||
| 2. | ALA5098053 | F | Antiviral activity against HIV 1 infected in human HeLa-MAGI cells assessed as inhibition of viral replication measured 24 hrs post infection by fluorescence based analysis | Human immunodeficiency virus 1 | 21 | organism-based format | Scientific Literature | ||
| 3. | ALA5098054 | T | Cytotoxicity against human HeLa-MAGI cells assessed as reduction in cell viability measured after 24 hrs by celltiter 96 aqueous one solution cell proliferation assay | Homo sapiens | 20 | cell-based format | Scientific Literature | ||
| 4. | ALA5098055 | T | Selectivity index, ratio of CC50 for cytotoxicity against human HeLa-CD4-LTR-beta-gal cells to EC50 for antiviral activity against HIV 1 infected in human HeLa-CD4-LTR-beta-gal cells | 11 | cell-based format | Scientific Literature |
The page will load shortly, Thanks for your patience!