# | Aladdin ID | Assay Type | Description | Organism | Compounds | Reference | BAO Format | Source | |
---|---|---|---|---|---|---|---|---|---|
1. | ALA828388 | B | inhibitory concentration against RNA dependent RNA polymerase Nonstructural protein 5B of hepatitis C virus | Hepacivirus hominis | 7 | single protein format | Scientific Literature | ||
2. | ALA864354 | B | Inhibitory activity against HCV 1b BK NS5B deltaC55 RNA polymerase | Hepatitis C virus subtype 1b | 41 | single protein format | Scientific Literature | ||
3. | ALA863192 | F | Inhibition of replication of HCV 1b BK RNA in Huh7 cells at 100 uM in presence of 10% fetal calf serum | 6 | cell-based format | Scientific Literature | |||
4. | ALA853025 | P | Lipophilicity as measured by LogD at pH 7.4 | 5 | small-molecule physicochemical format | Scientific Literature | |||
5. | ALA854142 | B | Inhibitory activity against HCV 1b BK NS5B deltaC55 RNA polymerase involving magnesium chelation | Hepatitis C virus subtype 1b | 9 | single protein format | Scientific Literature | ||
6. | ALA862541 | B | Inhibitory activity against HCV 1b BK NS5B deltaC55 RNA polymerase involving manganese chelation | Hepatitis C virus subtype 1b | 9 | single protein format | Scientific Literature | ||
7. | ALA862542 | P | Dissociation constant, pKa of the compound | 9 | small-molecule physicochemical format | Scientific Literature | |||
8. | ALA862549 | B | Inhibitory activity against HCV 1b BK NS5B deltaC55-R158M mutant RNA polymerase | Hepatitis C virus subtype 1b | 3 | single protein format | Scientific Literature | ||
9. | ALA862550 | B | Inhibitory activity against HCV 1b BK NS5B deltaC55-R158K mutant RNA polymerase | Hepatitis C virus subtype 1b | 3 | single protein format | Scientific Literature | ||
10. | ALA890062 | B | Inhibition of HCV NS5b polymerase | Hepatitis C virus | 1 | assay format | Scientific Literature | ||
11. | ALA982662 | F | Antiviral activity against HCV in human HBI10A cells by ELISA | Hepacivirus hominis | 9 | organism-based format | Scientific Literature | ||
12. | ALA1116600 | F | Inhibition of HCV1b Cdelta55 NS5B polymerase | Hepatitis C virus subtype 1b | 19 | organism-based format | Scientific Literature | ||
13. | ALA3619484 | B | Inhibition of ERCC1-XPF (unknown origin) by high-throughput fluorescence based in-vitro endonuclease assay | Homo sapiens | 38 | protein complex format | Scientific Literature | ||
14. | ALA3619485 | B | Inhibition of FEN1 (unknown origin) | Homo sapiens | 38 | single protein format | Scientific Literature | ||
15. | ALA3619486 | B | Inhibition of DNAse1 (unknown origin) | Homo sapiens | 30 | single protein format | Scientific Literature | ||
16. | ALA4221316 | B | Inhibition of HIV1 reverse transcriptase p66/p51 polymerase using PPT57 DNA/Cy5-labeled PPT24 as template/primer preincubated for 10 mins followed by dNTP addition measured after 5 mins by bromophenol blue staining based phosphor imaging analysis | Human immunodeficiency virus 1 | 26 | single protein format | Scientific Literature | ||
17. | ALA5163692 | B | Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctggcgtaatagcgaagaggcccgca ssDNA as substrate at 5 uM preincubated for 15 mins followed by substrate addition for 30 mins by plate reader assay relative to control | Cytomegalovirus | 57 | assay format | Scientific Literature | ||
18. | ALA5163693 | B | Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctggcgtaatagcgaagaggcccgca ssDNA as substrate preincubated for 15 mins followed by substrate addition for 30 mins by plate reader assay | Cytomegalovirus | 38 | assay format | Scientific Literature | ||
19. | ALA5163694 | B | Binding affinity to human cytomegalovirus pUL89 assessed as change in melting temperature at 20 uM preincubated for 15 mins by Thermal shift assay | Cytomegalovirus | 57 | single protein format | Scientific Literature | ||
20. | ALA5163695 | F | Antiviral activity against human cytomegalovirus expressing ADCREGFP infected in HFF cells assessed as inhibition in viral replication by measuring GFP fluorescence incubated for 168 hrs by cell based assay | Cytomegalovirus | 10 | organism-based format | Scientific Literature |