# | Aladdin ID | Assay Type | Description | Organism | Compounds | Reference | BAO Format | Source | |
---|---|---|---|---|---|---|---|---|---|
1. | ALA834777 | B | Percentage inhibition of RNA dependent RNA polymerase Nonstructural protein 5B of hepatitis C virus at 50 uM | Hepacivirus hominis | 8 | single protein format | Scientific Literature | ||
2. | ALA3619484 | B | Inhibition of ERCC1-XPF (unknown origin) by high-throughput fluorescence based in-vitro endonuclease assay | Homo sapiens | 38 | protein complex format | Scientific Literature | ||
3. | ALA3619485 | B | Inhibition of FEN1 (unknown origin) | Homo sapiens | 38 | single protein format | Scientific Literature | ||
4. | ALA3619486 | B | Inhibition of DNAse1 (unknown origin) | Homo sapiens | 30 | single protein format | Scientific Literature | ||
5. | ALA5163692 | B | Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctggcgtaatagcgaagaggcccgca ssDNA as substrate at 5 uM preincubated for 15 mins followed by substrate addition for 30 mins by plate reader assay relative to control | Cytomegalovirus | 57 | assay format | Scientific Literature | ||
6. | ALA5163693 | B | Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctggcgtaatagcgaagaggcccgca ssDNA as substrate preincubated for 15 mins followed by substrate addition for 30 mins by plate reader assay | Cytomegalovirus | 38 | assay format | Scientific Literature | ||
7. | ALA5163694 | B | Binding affinity to human cytomegalovirus pUL89 assessed as change in melting temperature at 20 uM preincubated for 15 mins by Thermal shift assay | Cytomegalovirus | 57 | single protein format | Scientific Literature | ||
8. | ALA5163695 | F | Antiviral activity against human cytomegalovirus expressing ADCREGFP infected in HFF cells assessed as inhibition in viral replication by measuring GFP fluorescence incubated for 168 hrs by cell based assay | Cytomegalovirus | 10 | organism-based format | Scientific Literature | ||
9. | ALA5163696 | T | Cytotoxicity against HFF cells assessed as cell viability incubated for 168 hrs by MTS-based Cell Titer assay | Homo sapiens | 10 | cell-based format | Scientific Literature | ||
10. | ALA5163697 | T | Selectivity index, ratio of CC50 for cytotoxicity against HFF cells to EC50 for antiviral activity against human cytomegalovirus expressing ADCREGFP infected in HFF cells | 10 | cell-based format | Scientific Literature | |||
11. | ALA5163703 | A | Apparent permeability coefficient of the compound incubated for 5 hrs by LC-MS/MS analysis based PAMPA method | 10 | assay format | Scientific Literature |