#	Aladdin ID	Assay Type	Description	Organism	Compounds	Reference	BAO Format	Source
1.	ALA1657524	B	Inhibition of EGF-srimulated Stat1 phosphorylation in mouse NIH/3T3 cells overexpressing human EGFR at 40 uM after 15 to 60 mins by immunoblotting	Mus musculus	2	ALA1649103	cell-based format	Scientific Literature
2.	ALA1687313	B	Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by fluorescence polarization assay	Mus musculus	2	ALA1681633	assay format	Scientific Literature
3.	ALA1832674	B	Inhibition of mouse STAT1 using fluorescent probe 5-carboxyfluorescein-GpYLPQTV-NH2 after 30 mins by fluorescence polarisation assay	Mus musculus	1	ALA1828629	single protein format	Scientific Literature
4.	ALA2065326	B	Inhibition of STAT1 phosphorylation in LPS-induced mouse RAW264.7 cells incubated for 10 mins prior to LPS-challenge measured after 30 mins by Western blot analysis	Mus musculus	3	ALA2062365	cell-based format	Scientific Literature
5.	ALA2175194	B	Inhibition of STAT1 dimerization in EGF-stimulated mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT1-DNA interaction after 30 mins by EMSA	Mus musculus	1	ALA2169778	cell-based format	Scientific Literature
6.	ALA3128734	B	Effect on LPS-induced nuclear translocation of STAT1 in mouse RAW264.7 cells at 25 uM preincubated for 15 mins followed by LPS challenge measured after 6 hrs by Western blot analysis	Mus musculus	1	ALA3124901	cell-based format	Scientific Literature
7.	ALA3128736	B	Effect on LPS-induced STAT1 phosphorylation in mouse RAW264.7 cells at 3.1 to 25 uM preincubated for 15 mins followed by LPS challenge measured after 4 hrs by Western blot analysis	Mus musculus	1	ALA3124901	cell-based format	Scientific Literature
8.	ALA3632016	B	Inhibition of Stat1 dimer DNA binding activity in EGF-stimulated mouse NIH3T3 nuclear extract expressing human EGFR assessed as residual activity at 5 uM preincubated for 30 mins followed by addition of radiolabeled probe hSIE for 30 mins by EMSA	Mus musculus	6	ALA3627612	single protein format	Scientific Literature
9.	ALA3632018	B	Inhibition of Stat1 dimer DNA binding activity in EGF-stimulated mouse NIH3T3 nuclear extract expressing human EGFR at 5 uM preincubated for 30 mins followed by addition of radiolabeled probe hSIE for 30 mins by EMSA	Mus musculus	12	ALA3627612	single protein format	Scientific Literature
10.	ALA3632141	B	Modulation of EGF-induced Stat1 phosphorylation in mouse NIH3T3 cells expressing human EGFR at 5 uM preincubated for 3 hrs followed by stimulation with 1 ug/ml EGF for 12 mins by immunoblot analysis	Mus musculus	4	ALA3627612	cell-based format	Scientific Literature
11.	ALA3743447	B	Inhibition of IL6-induced STAT1 phosphorylation at Y701 in CD4+ T lymphocytes isolated from C57BL/6J mouse preincubated for 2 hrs followed by activation with plate-bound anti-CD3/anti-CD28 and IL6 for 15 mins by Western blot analysis	Mus musculus	6	ALA3739303	cell-based format	Scientific Literature
12.	ALA4423956	B	Inhibition of LPS-induced STAT1 phosphorylation at Y701 residue in mouse RAW264.7 cells at 5 uM preincubated for 30 mins followed by LPS-stimulation and measured up to 240 mins by Western blot analysis	Mus musculus	1	ALA4422643	cell-based format	Scientific Literature
13.	ALA4423958	B	Inhibition of LPS-induced STAT1 phosphorylation at Y701 residue in mouse RAW264.7 cells at 40 uM preincubated for 30 mins followed by LPS-stimulation and measured up to 240 mins by Western blot analysis	Mus musculus	1	ALA4422643	cell-based format	Scientific Literature
14.	ALA4477559	B	Inhibition of LPS-induced STAT1 phosphorylation at Y701 in mouse RAW264.7 cells at 15 to 60 uM preincubated for 1 hr followed by LPS challenge for 120 mins by Western blot analysis	Mus musculus	1	ALA4477178	cell-based format	Scientific Literature
15.	ALA4477560	B	Inhibition of LPS-induced STAT1 phosphorylation at S727 in mouse RAW264.7 cells at 15 to 60 uM preincubated for 1 hr followed by LPS challenge for 15 mins by Western blot analysis	Mus musculus	1	ALA4477178	cell-based format	Scientific Literature
16.	ALA4477562	B	Inhibition of LPS-induced STAT1 phosphorylation at Y701 in C57BL/6 mouse peritoneal macrophages at 15 to 60 uM preincubated for 1 hr followed by LPS challenge for 120 mins by Western blot analysis	Mus musculus	1	ALA4477178	single protein format	Scientific Literature
17.	ALA4477563	B	Inhibition of LPS-induced STAT1 phosphorylation at S727 in C57BL/6 mouse peritoneal macrophages at 15 to 60 uM preincubated for 1 hr followed by LPS challenge for 30 mins by Western blot analysis	Mus musculus	1	ALA4477178	single protein format	Scientific Literature
18.	ALA4712509	B	Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis	Mus musculus	5	ALA4706639	subcellular format	Scientific Literature
19.	ALA4712512	B	Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract at 10 uM preincubated for 30 mins followed by hSIE probe addition by EMSA analysis	Mus musculus	10	ALA4706639	tissue-based format	Scientific Literature
20.	ALA4723882	B	Inhibition of STAT1 phosphorylation in mouse BAF3 cells at 1000 nM after 2 hrs by Western blot analysis	Mus musculus	1	ALA4715869	cell-based format	Scientific Literature