#	Aladdin ID	Assay Type	Description	Organism	Compounds	Reference	BAO Format	Source
1.	ALA2175195	B	Inhibition of STAT1/STAT3 in EGF-stimulated mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT1/STAT3-DNA interaction after 30 mins by EMSA	Mus musculus	1	ALA2169778	cell-based format	Scientific Literature
2.	ALA3632014	B	Inhibition of Stat1:Stat3 dimer DNA binding activity in EGF-stimulated mouse NIH3T3 nuclear extract expressing human EGFR assessed as residual activity at 5 uM preincubated for 30 mins followed by addition of radiolabeled probe hSIE for 30 mins by EMSA	Mus musculus	6	ALA3627612	cell-based format	Scientific Literature
3.	ALA3632029	B	Inhibition of Stat1:Stat3 dimer DNA binding activity in EGF-stimulated mouse NIH3T3 nuclear extract expressing human EGFR at 5 uM preincubated for 30 mins followed by addition of radiolabeled probe hSIE for 30 mins by EMSA	Mus musculus	1	ALA3627612	cell-based format	Scientific Literature
4.	ALA4712508	B	Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1/STAT3 heterodimer in mouse NIH3T3 nuclear extract preincubated for 30 mins followed by hSIE probe addition by EMSA analysis	Mus musculus	5	ALA4706639	subcellular format	Scientific Literature