#	Aladdin ID	Assay Type	Description	Organism	Compounds	Reference	BAO Format	Source
1.	ALA4824588	B	Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate at 20 uM incubated for 30 mins by ELISA-based biochemical assay relative to control	Human betaherpesvirus 5	42	ALA4823278	single protein format	Scientific Literature
2.	ALA4824591	B	Inhibition of human cytomegalovirus pUL89 endonuclease activity using 60 bp dsDNA substrate incubated for 30 mins by ELISA-based biochemical assay	Human betaherpesvirus 5	24	ALA4823278	single protein format	Scientific Literature
3.	ALA4824592	B	Binding affinity to human cytomegalovirus pUL89 assessed as change in melting temperature at 20 uM by thermal shift assay	Human betaherpesvirus 5	25	ALA4823278	single protein format	Scientific Literature
4.	ALA5163692	B	Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctggcgtaatagcgaagaggcccgca ssDNA as substrate at 5 uM preincubated for 15 mins followed by substrate addition for 30 mins by plate reader assay relative to control	Cytomegalovirus	57	ALA5154836	assay format	Scientific Literature
5.	ALA5163693	B	Inhibition of human cytomegalovirus pHAR-UL89C expressed in Escherichia coli Rosette using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccattcgccagctggcgtaatagcgaagaggcccgca ssDNA as substrate preincubated for 15 mins followed by substrate addition for 30 mins by plate reader assay	Cytomegalovirus	38	ALA5154836	assay format	Scientific Literature
6.	ALA5163694	B	Binding affinity to human cytomegalovirus pUL89 assessed as change in melting temperature at 20 uM preincubated for 15 mins by Thermal shift assay	Cytomegalovirus	57	ALA5154836	single protein format	Scientific Literature
7.	ALA5163704	B	Inhibition of human cytomegalovirus pUL89-C using Digoxigenin-labeled 5'-taatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcac ssDNA as substrate preincubated for 15 mins followed by substrate addition for 1 hr by absorbance based analysis	Cytomegalovirus	1	ALA5154836	single protein format	Scientific Literature
8.	ALA5163710	B	Inhibition of human cytomegalovirus pUL89-C using dsDNA substrate preincubated for 15 mins followed by substrate addition for 1 hr by ELISA	Cytomegalovirus	1	ALA5154836	single protein format	Scientific Literature
9.	ALA5163711	B	Inhibition of human cytomegalovirus pUL89-C	Cytomegalovirus	1	ALA5154836	single protein format	Scientific Literature