| Product Description | Aladdin's FnCas12a, also known as Cpf1, is a recombinant RNA-guided DNA-editable endonuclease obtained by expression and purification on the PerfectProtein™ Platform developed by aladdin. It has a high gene editing efficiency with lower off-target effects. It is derived from Francisella novicida U112, with a molecular weight of approximately 154kDa. FnCas12a recognizes the TTN-containing PAM sequence and the cleavage site of FnCas12a is relatively far from its recognition site, providing the possibility for multiple editing, which makes Cas12a and Cas9 functionally complementary. By simply combining the guide RNA (gRNA) with the Cas12a protein, gene editing can be achieved without trans-activating crRNA (tracrRNA), as the gRNA contains only crRNA (Figure 1).The CRISPR-Cas system is widely found in bacteria and archaea as an adaptive immune system for prokaryotes that protects itself from exogenous DNA or RNA and is extensively used as a gene editing tool. The complete CRISPR-Cas system consists of CRISPR RNAs (crRNAs) that mediate recognition of target DNA and Cas endonucleases that mediate the cleavage of DNA.FnCas12a comprises approximately 1300 amino acids with a RuvC-like structural domain, and has both DNA and RNA endonuclease activities. Studies have shown that FnCas12a and Cas9 differ in their working mechanisms due to their different structures [1]. The CRISPR-Cas12a system is composed of Cas12a and gRNA (crRNA) requiring only about 40-44 bases. FnCas12a is guided by gRNA to the complementary strand of the target site, recognizes the T-base-rich (5'-TTN-3') PAM (Protospacer adjacent motif) sequence at the 5' end of the complementary strand, and then cleaves the complementary and the target strands one by one to produce a staggered DNA double-strand break at approximately the 18th base at the 3' end of the PAM sequence. The products after cleavage has sticky ends with 4 or 5 bases protruding from the 5' ends (Figure 1). The CRISPR-Cas9 system however is composed of Cas9 and gRNA including two RNA molecules, crRNA and tracrRNA. Cas9, guided by gRNA, recognizes a PAM sequence rich in G bases (5'-NGG-3') at the 3' end, and needs to use two nuclease structural domains, HNH and RuvC, to synergistically cleave DNA, with the break usually occurring at the third base of the 5' end of the PAM sequence, eventually producing a blunt end.Figure 1. Schematic diagram of sequence recognition and DNA cleavage of Aladdin's FnCas12a (Cpf1) Based on the Cas proteins in the crRNA effector complex, CRISPR-Cas systems are divided into two categories. Class I CRISPR-Cas systems function in multi-protein effector complexes and can be divided into three types and 12 isoforms, while Class II CRISPR-Cas systems can recognize and cleave exogenous DNA with only a single Cas protein effector, and can be divided into three types and nine isoforms. Class II CRISPR-Cas systems such as the well-known CRISPR-Cas9 system have been widely used because of their simple reaction mechanism. This product together with crRNA forms the CRISPR-Cas12a system that belongs to class II type 5 [2].The C-terminus of the FnCas12a (Cpf1) enzyme is fused with a nuclear localization signal (NLS), enabling the localization of FnCas12a in nucleus and improving the efficiency of gene editing.Please refer to Figure 2 for the performance of Aladdin's FnCas12a (Cpf1).Figure 2. Cleavage of target DNA by Cas12a from aladdin and Company N (Competitor). The pUC18 plasmid DNA were cleaved by different amounts of Cas12a as indicated in a 30μl reaction volume under the guidance of gRNA ( UAAUUUCUACUAAGUGUAGAUCUGUGUGAAAUUGUUAUCCG) according to the following instructions. The reaction products were examined by 1% agarose gel electrophoresis. As shown in the figure, this product has comparable performance to Competitor product in cleaving supecoiled pUC18 plasmid into linearized pUC18 with a slower migration rate. This figure is for reference only, which may vary due to different experimental conditions.
Application： Gene editing, gene detection, and linearization of double-stranded circular DNA such as mitochondrial or plasmid DNA.Purity: Free of DNA endonuclease, DNA exonuclease, and RNase. Concentration: 1μM (153.7ng/μl).Enzyme Storage Buffer: 500mM NaCl, 20mM Sodium acetate, 0.1mM EDTA, 0.1mM TCEP, 50% (v/v) Glycerol, pH6 at 25℃.10X Reaction Buffer: 500mM NaCl, 100mM Tris-HCl, 100mM MgCl2·6H2O, 1mg/mL BSA, pH7.9 at 25℃.Inactivation or Inhibition: This product can be inactivated by heating at 65℃ for 10 minutes.
Source： Expression of FnCas12a in E. coli.Applications: Gene editing, gene detection, and linearization of double-stranded circular DNA such as mitochondrial or plasmid DNA.Purity: Free of DNA endonuclease, DNA exonuclease, and RNase. Concentration: 1μM (153.7ng/μl).
Enzyme storage buffer： 500mM NaCl, 20mM Sodium acetate, 0.1mM EDTA, 0.1mM TCEP, 50% (v/v) Glycerol, pH6 at 25℃.
Inactivation or inhibition： This product can be inactivated by heating at 65℃ for 10 minutes.
Precautions： This product should be used under Nuclease-free conditions with extreme car to avoid contamination. All operations need to be performed in accordance with RNase-free requirements. For the removal of nucleases in the working environment, we recommend using RNase and DNase Away . RNase Inhibitor can also be added in the reaction mix to protect RNA from degradation.This product is for R&D only. Not for drug, household, or other uses.For your safety and health, please wear a lab coat and disposable gloves during the operation.
Instructions for Use： In vitro digestion of target DNA by FnCas12a (Cpf1) 1. Thaw the reagents and mix well before use. Keep FnCas12a, gRNA, and substrate DNA on ice. Dilute gRNA to 300nM and substrate DNA to 30nM in nuclease-free water.2. Set up the reaction in a microfuge tube as follows:Reagent Volume Nuclease-free water 20µl10X Reaction Buffer 3µlgRNA (300µM) 3µlFnCas12a (1μM) 1µlTotal Reaction Volume 27µl3. Mix well by pipetting or vortex gently, centrifuge briefly at room temperature to collect the liquid at the bottom of the tube, and incubate at 25⁰C for 10min. 4. Add 3μl of 30nM substrate DNA, mix gently by pipetting or vortex, and then centrifuge briefly. Incubate at 37⁰C for 10min. 5. Add 1μl of Proteinase K (, ST532) into the reaction, mix gently and incubate for 10 min at room temperature. 6. Add 6μl of DNA loading buffer (6X) (, D0071) into the reaction, and then examine the reaction products by 1% agarose gel electrophoresis.
|
|---|
