SP6 RNA Polymerase

Item Number

S750679

• Specifications & Purity: Free of RNase, DNA endonuclease and exonuclease.
• Stability And Storage: Store at -20℃.
• Storage Temp: Store at -20°C
• Shipped In: Ice chest + Ice pads
• Grade: EnzymoPure™

Product Description

The amount of enzyme required to catalyze the incorporation of 1nmol AMP into a polynucleotide within 60 minutes at 37℃ is defined as 1 unit of activity.Activity assay condition: 40mM Tris-HCl (pH8.0), 6mM MgCl2, 10mM DTT, 2mM spermidine, 0.5mM NTP, 0.6MBq/ml [3H]-ATP, 20µg/ml plasmid DNA containing the specific SP6 RNA Polymerase promoter sequence.

Application：

The SP6 RNA Polymerase is mainly used for RNA synthesis. The synthesized RNA can be used for hybridization, genomic DNA sequence analysis, RNase protection assay, antisense RNA synthesis, in vitro translation, RNA splicing studies, RNA secondary structure and RNA-protein interaction studies, nucleic acid amplification analysis, etc.

Source：

Recombinant SP6 RNA Polymerase expressed and purified from E. coli.

Enzyme storage buffer：

50mM Tris-HCl (pH 8.0), 150mM NaCl, 5mM DTT, 0.1mg/ml BSA, 0.5mM Elugent, 50% glycerol.

Inactivation or inhibition：

SP6 RNA Polymerase is inactivated by heating at 70℃ for 10 minutes or adding an appropriate amount of EDTA. Chelators, sodium, potassium or ammonium salts at concentrations greater than 150mM can significantly inhibit the activity of SP6 RNA Polymerase.The SP6 consensus promoter sequence is as follows:-15 -10 -5 +1 +5TAATACGACTCACTATAGGGAGA

Precautions：

Keep SP6 RNA Polymerase on ice while handling, and store at -20℃ immediately after use.This product is for R&D only. Not for drug, household, or other uses.For your safety and health, please wear a lab coat and disposable gloves during the operation.

Instructions for Use：

1. RNA synthesisa. To prepare the linearized DNA template for transcription, digest the plasmid with appropriate endonucleases.b. Purify the DNA using phenol/chloroform extraction followed by ethanol precipitation, or using 's DNA purification kit .c. Set up the following reaction at room temperature:ComponentVolumeTranscription Buffer (5X)10µlNTP Mixture (10mM each)10µlLinearized DNA Template1µgRibonuclease Inhibitor50USP6 RNA Polymerase30UDEPC-treated Waterto 50µld. Mix well by vortex or pipetting gently, centrifuge briefly to collect liquid at the bottom of centrifugation tube.e. Incubate at 37℃ for 1-2 hours.f. Add 2µl of 0.5M EDTA (pH 8.0) or freeze at -20℃ to stop the reaction.g. Analyze the transcription product by electrophoresis or other appropriate methods.Note 1: RNase contamination must be avoided.Note 2: Due to the potential precipitation of DNA in the presence of spermidine, the reactions must be prepared at room temperature.Note 3: Under the above reaction conditions, more than 10µg of RNA can be synthesized from 1µg of template DNA.Note 4: Due to the high processivity of SP6 RNA polymerase, circular plasmid templates will generate long heterogeneous RNA transcripts in higher quantities compared to linear templates. Therefore, it is important to use completely linearized plasmid as template to ensure efficient synthesis of RNA transcripts of defined length.Note 5: The above reaction can be scaled up or down as needed.2. Synthesis of radio-labeled RNAa. To prepare the linearized DNA template for transcription, digest the plasmid with appropriate endonucleases.b. Purify the DNA using phenol/chloroform extraction followed by ethanol precipitation, or using 's DNA purification kit .c. Set up the following reaction at room temperature:ComponentVolumeTranscription Buffer (5X)4µl3 NTP Mixture (10mM each, without CTP)1µl100µM CTP2.4µl[α-32P]-CTP, ~30TBq/mmol (800Ci/mmol)1.85MBq (50µCi)Linear DNA Template0.2~1µgRibonuclease Inhibitor20USP6 RNA Polymerase20UDEPC-treated waterto 20µld. Incubate at 37℃ for 1-2 hours.e. Freeze at -20℃ to terminate the reaction.f. Examine the labeling efficiency.Note 1: The RNA activity synthesized by the above method is generally 3-5×108dpm/µg.Note 2: NTPs labeled with [32P], [35S], or [3H] can also be used in the transcription reaction and the doses of reaction components should be adjusted accordingly. The recommended doses of labeled NTPs in a 20µl transcription reaction are as follows: 1.85MBq (50µCi) 5'-[α-32P]-CTP, ~30TBq/mmol (800Ci/mmol); 11.1MBq (300µCi) 5'-[α-35S]-UTP, ＞37TBq/mmol (＞1000Ci/mmol); 0.925MBq (25µCi) 5,6-[3H]-UTP, 1.1-2.2TBq/mmol (30-60Ci/mmol).Note 3: The efficiency of full-length transcript synthesis decreases when the concentration of radioactively labeled NTP is below 12µM.3. For other applications, please refer to the protocol above or other relevant literature.